• 专利附录
  • 专利说明
  • 权利要求
  • 类似技术
  • 同族专利
  • 引用文献
  • 法律状态
  • 优先权
    • 专利摘要:
    The present invention relates to three sets of novel primers of SEQ ID Nos. 1-6, wherein said three sets of primer are designed from three genes omt, ord, and aflR respectively of aflatoxin biosynthesis pathway of fungi Aspergillus flavus and an improved use of identifying aflatoxinogenic aspergilli using said three sets of primers.
    公开号:CA2480472A1
    申请号:C2480472
    申请日:2002-03-26
    公开日:2003-10-02
    发明作者:Haravey Krishnan Manonmani；Arun Chandrashekar；Eddiya Rati Rao
    申请人:Council Of Scientific And Industrial Research；Haravey Krishnan Manonmani；Arun Chandrashekar；Eddiya Rati Rao；
    IPC主号:C12Q1-68
    专利说明:
    NOVEL PRIMERS FOR IDENTIFYING AFLATOXINOGENIC ASPERGILLI AND AN IMPROVED USE THEREOF Technical Field The present invention relates to three sets of novel primers of SEQ ID Nos. 1-6, wherein said three sets of primer are designed from three genes omt, or~d, and afl R respectively of aflatoxin biosynthesis pathway of fungi Aspe~gillus flavus and an improved use of identifying aflatoxinogenic aspe~gilli using said three sets of primers.l0 Background Art Aflatoxins are potent carcinogenic, mutagenic and teratogenic metabolites produced primarily by the fungal species of Aspe~gillus flavus and Aspergillus pa~asiticus. Foods and feeds, especially in warm climates are susceptible to invasion by aflatoxigenic Aspe~gillus sp. And subsequent production of Aflatoxins during preharvesting, processing, transportation or storage. Over the last few years, means for mycotoxin detection have been simplified, by the adoption of immmzological methods. The level of mold infestation and identification of the governing species are important parameters which could give an indication of the quality of the material and future potential for the presence of mycotoxins.2o Mold counts are a part of quality control assurance for foods. This use is time consuming , labour intensive , costly requires facilities and mycological expertise and do not allow the specification of mycotoxegenic fungi.With the advances made in the detection methods, polymerase chain reaction (PCR) facilitates in vitYO amplification of target sequence and offers several advantages over traditional methods of detection.Reference may be made to the work of Miller and Martin (1988) for the application of PCR techniques for the detection of microorganisms, including plant pathogens . However no attempt has been made to detect aflatoxin-producing fungi.Reference may be made to the works of Payne and Woloshuk (1989) and Nu, et al (1995).3o Who have identified the genes in Aflatoxins biosynthetic pathway of strains of A. flavus and A. pa~asiticus. However, detection of aflatixigenic fungi were not attempted.Reference may be made to the work of Shapira, et al (1996) , where in the identification of aflatoxin producing molds in grains has been attempted using PCR techniques. Three genes ver - 1, omt - 1 and apa - 2 coding for key enzymes and regulatory factor in biosynthesis of aflatoxin were used as primers. Positive results were obtained in 24h enriched cultures at lowest spore level of 102 spores per gram. However incubation of dried ground corn seeds in enrichment media allowed detection as few as 102 spores per gram after 48h of incubation. The drawback of these references is that no attempts have been made to detect aflatoxigenic fungi and the traditional methods are non-sensitive, time consuming and lack consistency. The present invention enables detection of aflatoxigenic fungi by PCR using specific aflatoxin biosynthetic pathway genes. This use has application in food system. Objects of the present invention The main object of the present invention is to develop primers from genes of aflatoxin biosynthesis pathway.l0 Another main object of the present invention is to develop primers for genes onzt, ord, and afl R of aflatoxin biosynthesis pathway.Yet another object of the present invention is to develop an improved use for identifying aflatoxinogenic aspergilli.Still another object of the present invention is to develop an improved use for identifying aflatoxinogenic aspergilli using said primers.Still another object of the present invention is to develop a use of identifying aflatoxinogenic aspergilli directly in food articles.Still another object of the present invention is to develop a highly sensitive use to identifying aflatoxinogenic aspergilli.2o Further object of the present invention is to develop an identification use using multiple number of primers for more accuracy. Summary of the present invention The present invention relates to three sets of novel primers of SEQ ID Nos. 1-6, wherein said three sets of primer are designed from three genes onzt, ord, and afl R respectively of aflatoxin biosynthesis pathway of fungi Aspe~gillus flavus and an improved use of identifying aflatoxinogenic aspergilli using said three sets of primers. Detailed description of the present invention Accordingly, the present invention relates to three sets of novel primers of SEQ ID Nos. 1 6, wherein said three sets of primer are designed from three genes o~yat, ord, and afl Rrespectively of aflatoxin biosynthesis pathway of fungi Asper~gillus flavus and an improved use of identifying aflatoxinogenic asper~gilli using said three sets of primers.In one embodiment of the present invention, three sets of oligonucleotide primers of SEQ117 Nos. 1 through 6. (Please refer sequences shown below).omt 1 ( F ) 5~ AGCGTCCGAATCCCTTTAAT 3~ (SEQ ID NO. 1) ( R ) 5~ AGGGTGTTCGCCAATCATAG 3~ (SEQ ID NO. 2) or~d ( F ) 5~, ACTGCCCCTCAGCTAACCTC 3~ ,(SEQ ID NO. 3) ( R ) 5 GCATCAGCATTCTTCCAAGG 3 (SEQ 117 NO. 4) aflR ( F ) 5~ AACCGCATCCACA ATCTCAT 3~ (SEQ 117 NO. 5) ( R ) 5 AGTGCAGTTCGCTCAGAACA3 (SEQ TD NO. 6) In further embodiment of the present invention, said three sets of primer of SEQ ID Nos.1-6 used together shows more accurate identification as compared to any one set of primer alone.l0 In another embodiment of the present invention, wherein said primers are designed from genes of aflatoxin biosynthesis pathway of fungi Aspe~gillus flavus.In yet another embodiment of the present invention, wherein said primers are designed for three specific genes onzt, ord, and afl R.In still another embodiment of the present invention, wherein primers 1 and 2 correspond to gene omt encoding o-methyl transferase.In still another embodiment of the present invention, wherein primers 3 and 4 correspond to gene oy~d encoding oxidoreductase.In still another embodiment of the present invention, wherein primers 5 and 6 correspond to gene afl R encoding aflatoxin regulatory protein.2o In still another embodiment of the present invention, wherein primers 1, 3, and 5 are forward primers.In still another embodiment of the present invention, wherein primers 2, 4, and 6 are reverse primers.In still another embodiment of the present invention, wherein length of primers is 20 base pairs (bp).In further embodiment of the present invention, sequences of three genes omt, ordA, and afl R are as follows:A. O methyltransferase (Omt) gene from the published gene sequence with Accession no L25834 where the primers covers the region between 1811 to 2218 with the product size 407 by of SEQ T17 NO. 7.B. Oxidoreductase (ord) gene from the published gene sequence with Accession no AF169016 where the primer covers the region between 3142 to 3530 with product size 388 by of SEQ ID NO. 8.C . Aflotoxin regulatory gene (aflR) from the published gene sequence with Accession no AF 264763 where the said primer covers the region between 540 to 1338 with the product size 798 by of SEQ ID NO. 9.
    In further embodiment of the present invention, an improved use of identifying aflatoxigenic aspergilli using primers of claim 1 independently or in combination.Tn another embodiment of the present invention, harvesting mixed microflora from food system.In yet another embodiment of the present invention, extracting DNA from said harvested flora. (Please refer figure 1, and 2) Brief description of the accompanying drawings Figure 1 shows amplicons from the PCR with three sets of primers from DNA of Aspe~gillus flavus ATCC 46283. a, b, c, d, , DNA isolated from samples harvested at l0 12,24,36 and 48 hours and amplified with primers for the aflR gene Figure 2 shows amplicons from the PCR with three sets of primers from DNA of Aspe~gillus flavus ATCC 46283. e, f, g, h DNA isolated from samples harvested at 12,24,36 and 48 hours and amplified with primers for the onat gene In still another embodiment of the present invention, amplifying DNA by PCR using said primers. (Please refer figure 1, and 2) In still another embodiment of the present invention, analyzing amplified DNA by electrophoresis.In still another embodiment of the present invention, identifying aflatoxigenic fungi.Tn still another embodiment of the present invention, wherein fungi are harvested by centrifugation.In still another embodiment of the present invention, wherein DNA is extracted using mixture of phenol, chloroform, and amyl alcohol in ratio of about 25:24:1.In still another embodiment of the present invention, wherein primers axe designed using software programme Primer 3ØIn still another embodiment of the present invention, wherein primers 1 and 2 amplify 406 base pairs (bp) fragment of gene omt.In still another embodiment of the present invention, wherein primers 3 and 4 amplify 387 base pairs (bp) fragment of gene ord.In still another embodiment of the present invention, wherein primers 5 and 6 amplify 1299 base pairs (bp) fragment of gene afl R.In still another embodiment of the present invention, wherein amplification mixture for amplifying DNA comprises Tris-HCI, Potassium Chloride (KCl), Magnesium Chloride (MgCl2), gelatin, deoxyribonucleoside triphosphates, primers, Taq DNA polymerase, and sterile ultra filtered water. In still another embodiment of the present invention, wherein electrophorizing amplified DNA using agarose gel.In still another embodiment of the present invention, wherein said use identifies aflatoxigenic fungi as young as 12 hrs old.
    5 In still another embodiment of the present invention, wherein said use is particularly useful in detecting aflatoxigenic Aspe~gillus flavus, and Aspergillus pa~asiticus.In still another embodiment of the present invention, wherein said use detects aflatoxigenic fungi directly in food grains.In still another embodiment of the present invention, wherein said use detects aflatoxigenic to fungi from 10-Z to 10-6 cell numbers in grains.In still another embodiment of the present invention, wherein said use extracts DNAwithout using liquid nitrogen.In still another embodiment of the present invention, said use with three sets of primer use together shows more accurate identification as compared to any one set of primer alone.Accordingly, the present invention provides an improved use for the detection of aflatoxigenic molds in food systems which comprises a). Designing a set of novel nucleotide primers for o-methyl transferase , oxidoreductase and aflatoxin regulatory genes in Aspe~gillus flavus which may be selected from the sequence of omt 1 ( F ) S~(SEQ ID NO. AGCGTCCGAATCCCTTTAAT 3~ 1) , (SEQ ID NO.( R ) 5 AGGGTGTTCGCCAATCATAG 32) ord ( F ) 5~ ACTGCCCCTCAGCTAACCTC 3~ (SEQ m NO.3) 2s ( R ) 5~ GCATCAGCATTCTTCCAAGG 3, (SEQ m NO.4) aflR ( F ) 5~, AACCGCATCCACA ATCTCAT ~ (SEQ m 3 NO. 5) ( R ) 5 AGTGCAGTTCGCTCAGAACA3 (SEQ m NO.
    6) 3o b). A use for detection of aflatoxigenic fungi using primers specific for omt, ord and afl Rgene in a mixed microflora.c). Extraction of template DNA from moulds in grains or other food commodities.d). Extraction of template DNA from Aspergillus flavus, Aspergillus parasiticus and Fusariun2 sp. may be effected by grinding the fungal mass in Tris - EDTA (SOmM:35 SmM ) buffer containing % sodium dodocyl sulphate ( SDS ), followed by extraction using phenol : iso- amyl alcohol at 25 : 24 : 0.1. e). The PCR reaction mixture in a total volume of 25 ~1 may consist of buffer 2.5 ~,1,d NTPmix 0.5 ~1, taq - polymerase 0.3 ~1, water 18.78 ~1 , each specific primer -forward 1 ~1, reverse 1 ~.1 and template DNA 1 ~.1.f). Detection of aflatoxigenic fungi by amplification of target gene may be effected from an initial denaturation at 90° - 98°C fox 2 - 8min, amplification cycle of 28 to 40 ,each cycle with a denaturation at 90° - 98°C for 40 -70secs,annealing at 46° - 62°C for 40 -80secs and an extension at 68° - 76°C for 4 to l2min.g). The analysis of the PCR product may be achieved in 1.2 - 1.8% agarose gel electrophoresis, visualization of PCR product by staining with 0.5 ~.g /ml ethidium bromide and observation in a UV - transilluminator.i). Detection of time course may be effected indicating the rapidity of detection.j). Detection of aflatoxigenic moulds amongst different moulds may be effected indicating high sensitivity of the reaction.In an embodiment of the present invention, effective amplification of o-methyl transferase, oxidoreductase and aflatoxin regulatory genes may be effected at initial denaturation at 93 °- 95°C for 4 - 6min, amplification cycles of 32 - 38, each cycle with a denaturation at 93°- 95°C for 55 - 65 seconds annealing at 48° - 52°C for 55 - 65 seconds and an extension at 70° - 74°C for 55 - 65 seconds and a final extension at 68° - 76°C for 6 - lOmin.In another embodiment of the present invention, the PCR use can detect from 12 to 120h old mycelia.In yet another embodiment of the present invention, the PCR use may detect toxigenic fungi directly in grains.The patent relates to PCR use for the detection of aflatoxigenic fungi. Polymerase chain reaction use was used to selectively amplify o-methyl transferase, oxidoreductase and 3o aflatoxin regulatory genes in toxigenic fungi. Fungi grown in czapek-dox or potato dextrose broth or from contaminated grains were used for the isolation of template DNA.The PCR reaction mixture and amplification conditions were optimized for specific amplification. Visualization of PCR products revealed that by the use followed, it is possible to detect toxigenic fungi from 10-2 to 10-6 cell numbers in grains and only from aflatoxigenic fungi.
    The novelty of this use is the use of the designed primers for the direct detection of aflatoxigenic moulds by PCR. This use can detect aflatoxigenic fungi from contaminated grains. The use is rapid and sensitive making it possible to detect aflatoxigenic fungi from contaminated food systems without culturing them.The following examples are given by way of illustrations of the present invention and therefore should not be construed to limit the scope of the present invention. Example 1 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene c Aspe~gillus flavus were designed based on the gene sequence (ENTREZ) using the softwar to programme primer 3Ø These primer sets amplify 406, 387and 1299 base pair (bp) respectivel fragment of the gene, the sequence of which is given below. Sterilization of media and othe solutions was achieved by autoclaving for 20 min. at 121°C.omtl(F)S~AGCGTCCGAATCCCTTTAAT 3~omt 2 ( R ) 5~ AGGGTGTTCGCCAATCATAG 3~of°d 1 ( F ) 5~ ACTGCCCCTCAGCTAACCTC 3~ord 2 ( R ) 5~ GCATCAGCATTCTTCCAAGG 3~aflR 1 ( F ) 5~ AACCGCATCCACA ATCTCAT 3~2o afl R 2 ( R ) 5~ AGTGCAGTTCGCTCAGAACA3~Ten ml of Czapek-dox or potato dextrose broth was inoculated with 1 ml spore suspension of Aspergillus flavus ATCC 46283, Aspergillus oclzraceus CFR 221 and Fusarium trici~zctum NRRL 32998 separately and the flasks were incubated for 120h at ambient temperature (26° - 28°C) under stationary conditions. The mycelia were harvested by centrifugation, washed well with buffer, ground well using lysis buffer after freezing in liquid nitrogen. After lh of incubation at 65°C, DNA was extracted using phenol:chloroform: amyl alcohol mixture at 25:24:1 concentration. The aqueous phase was redissolved in Tris-EDTA buffer.3o Amplification was performed in a total reaction volume of 25p1 which contained 1 x PCRbuffer (10 mM Tris-HCI, pH 9.0, 50 mM KCI, 1.5 mM MgCl2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nm of each primer and unit of taq DNA polymerase and sterile ultra filtered water. Template DNAs were initially denatured at 94°C for 4 min.Subsequently, a total of 35 amplification cycle was carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec, at 94°C, primer annealing for 45 secs.at 50°C , 58°C and 62°C separately and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at 72°C for 10 min.
    PCR products were analysed by agarose gel electrophoresis. Aliquots of 10,1 PCRproducts were mixed with 2.0 p,l of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAE buffer. Gel was stained with ethidium bromide (0.5 ~g /ml), destained with distilled water and examined on a UVtransilluminator. A 100 by ladder was used as a molecular size marker. The amplification profile in the gel was documented in a CCD-camera based gel documentation system.Specific amplicons of 406, 387, and 1299 by for omt, ord and czfl R were observed with Aspeygillus flavus template DNA while, Aspefgillus och~aceus and Fusa~ium t~icihctum template genes did not show amplification.1o Example 2 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene of Aspe~gillus flavus were designed based on the gene sequence (ENTREZ) using the software programme primer 3Ø These primer sets amplify 406, 387, and 1299 base pair (bp) fragment of the gene, the sequence of which is given below. Sterilization of media and other solutions was achieved by autoclaving for 20 min. at 121 °C.omt 1 ( F ) 5~ AGCGTCCGAATCCCTTTAAT 3~onat 2 ( R ) 5~ AGGGTGTTCGCCAATCATAG 3~o~d 1 ( F ) 5~ ACTGCCCCTCAGCTAACCTC 3~ord 2 ( R ) 5~ GCATCAGCATTCTTCCAAGG 3~aflR 1 ( F ) 5~ AACCGCATCCACA ATCTCAT 3~afl R 2 ( R ) 5~ AGTGCAGTTCGCTCAGAACA3~Ten ml of Czapek-dox or potato dextrose broth was inoculated with 1 ml spore suspension of Aspe~gillus flavus ATCC 46283 and the flasks were incubated for 120h at ambient temperature (26° - 28°C) under stationary conditions. The mycelia were harvested by centrifugation, washed well with buffer, ground well using lysis buffer after freezing in liquid nitrogen. After lh of incubation at 65°C, DNA was extracted using phenol 3o chloroform : amyl alcohol mixture at 25:24:1 concentration. The aqueous phase was redissolved in Tris-EDTA buffer Amplification was performed in a total reaction volume of 251 which contained 1 x PCRbuffer (10 mM Tris-HCI, pH 9.0, 50 mM KCI, 1.5 mM MgCl2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nm of each primer and unit of taq DNA polymerase and sterile ultra filtered water. Template DNAs were initially denatured at 94°C for 4 min.Subsequently, a total of 35 amplification cycle was carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec. at 94°C, primer annealing for 45 secs.at SO°C , 58°C and 62°C separately and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at 72°C for 10 min.PCR products were analysed by agarose gel electrophoresis. Aliquots of 101 PCRproducts were mixed with 2.0 p,l of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAE buffer. Gel was stained with ethidium bromide (0.5 pg /ml), destained with distilled water and examined on a UVtransilluminator. A 100 by ladder was used as a molecular size marker. The amplification profile in the gel was documented in a CCD-camera based gel documentation system.At 50°C amplification was observed in all 3 primers. At 55°C omt did not show any to amplicons. However for ord and afl R primers the amplicons were observed. At 62°C all the primers showed no amplicons production. Example 3 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene of Aspe~gillus flavus were designed based on the gene sequence (ENTREZ) using the software programme primer 3Ø These primer sets amplify 406, 387, and 1299 base pair (bp) fragment of the gene, the sequence of which is given below. Sterilization of media and other solutions was achieved by autoclaving for 20 min. at121 °C.omt 1 ( F ) 5~ AGCGTCCGAATCCCTTTAAT 3~omt 2 ( R ) 5~ AGGGTGTTCGCCAATCATAG 3~ord 1 ( F ) 5~ ACTGCCCCTCAGCTAACCTC 3~o~d 2 ( R ) 5 GCATCAGCATTCTTCCAAGG 3 aflR 1 ( F ) 5~ AACCGCATCCACA ATCTCAT 3~of R 2 ( R ) 5~ AGTGCAGTTCGCTCAGAACA3~Ten ml of Czapek-dox or potato dextrose broth was inoculated with 1 ml spore suspension of Aspergillus flavus ATCC 46283 and the flasks were incubated for 120h at ambient temperature (26° - 28°C) under stationary conditions. The mycelia were harvested at different periods from 12h through 144h by centrifugation, washed well with buffer, ground well using lysis buffer after freezing in liquid nitrogen. After lh of incubation at 65°C, DNA was extracted using phenol : chloroform : amyl alcohol mixture at 25:24:1 concentration. The aqueous phase was redissolved in Tris-EDTA buffer.Amplification was performed in a total reaction volume of 25p,1 which contained 1 x PCRbuffer (10 mM Tris-HCl, pH 9.0, SO mM KCl, 1.5 mM MgCl2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nM of each primer and unit of taq DNA polymerase and sterile ultra f ltered water. Template DNAs were initially denatured at 94°C for 4 min. Subsequently, a total of 35 amplification cycle was carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec. at 94°C, primer annealing for 45 secs at 50°C , and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at 72°C for 10 min.5 PCR products were analysed by agarose gel electrophoresis. Aliquots of 101 PCRproducts were mixed with 2.0 p,l of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAE buffer. Gel was stained with ethidium bromide (0.5 ~.g /ml), destained with distilled water and examined on a UVtransilluminator. A 100 by ladder was used as a molecular size marker. The amplification to profile in the gel was documented in a CCD-camera based gel documentation system.Amplification could be observed from DNA extracted from 24h to 120h grown mycelia. Amplifications were observed with oryat, oy°d and afl R primers. Example 4 Oligonucleotide primers for o-methyltransferase, oxidoreductase, and aflatoxin regulatory gene of Aspe~gillus flavus were designed based on the gene sequence (ENTREZ) using the software programme primer 3Ø These primer sets amplify 406, 387, and 1299 base pair (bp) fragment of the gene, the sequence of which is given below. Sterilization of media and other solutions was achieved by autoclaving for 20 min. atI2I °C.omt 1 ( F ) 5~ AGCGTCCGAATCCCTTTAAT 3~omt 2 ( R ) 5~ AGGGTGTTCGCCAATCATAG 3~o~d 1 ( F ) 5~ ACTGCCCCTCAGCTAACCTC 3~o~d 2 ( R ) 5~ GCATCAGCATTCTTCCAAGG 3~aflR 1 ( F ) 5~ AACCGCATCCACA ATCTCAT 3~aflR 2 ( R ) 5 AGTGCAGTTCGCTCAGAACA3 One ml spore suspensions of 27 different fungi, belonging to Fusarium spp (6 no.)., Aspeygillus flavus (6 nos.), Aspergillus parasiticus.(3nos.), Aspergillus spp, (4 nos.), Aspergillus o~yzae ( 3 saos.),Rhizopus spp (3 nos.) were inoculated to potato -dextrose broth and incubated at ambient temperatures (26° - 28°C ) under stationary conditions for 96h . DNA was extracted . from ground mycelia without liquid nitrogen treatment.Amplification was performed in a total reaction volume of 25p,1 which contained 1 x PCRbuffer (10 mM Tris-HCI, pH 9.0, 50 mM KCI, 1.5 mM MgCl2, 0.01% gelatin), each of deoxyribonucleoside triphosphate,4nm of each primer and unit of taq DNA polymerase and sterile ultra filtered water. Template DNAs were initially denatured at 94°C for 4 min.Subsequently, a total of 35 amplification cycles were carried out in a programmable thermocycler. Each cycle consisted of denaturation for 30 sec. At 94°C, primer annealing for 45 secs.at 50°C and an extension for 1.15 min. at 72°C . The last cycle was followed by a final extension at 72°C for 10 min.PCR products were analysed by agarose gel electrophoresis. Aliquots of lOp,l PCRproducts were mixed with 2.0 ~.1 of loading dye and loaded on to 1.2% agarose gel and subjected to electrophoresis for 2h at 100 volts in 1 x TAE buffer. Gel was stained with ethidium bromide (0.5 ~,g /ml), destained with distilled water and examined on a UVtransilluminator. A 100 by ladder was used as a molecular size marker. The amplification profile in the gel was documented in a CCD-camera based gel documentation system to The template DNA from Rhizopus 3spp (2 )Aspergillus flavus (2), Fusay-ium strains (6) and Aspergillus (4), Aspergillus o~yzae (5) strains did not show any amplification.However, toxin producing Aspe~gillus flavus (4) and Aspe~gillus pa~asiticus (3) showed amplifications. The main advantages of the present invention are:1. The designed o-methyltransferase, oxidoreductase, and aflatoxin regulatory primers are specific for the detection of aflatoxigenic fungi.2~. The designed primers can detect aflatoxigenic fungi even at 24h of growth.3. The designed primers can specifically detected fungi possessing aflatoxin-producing genes.4. A simple and effective use has been used for the isolation of template DNA without the application of liquid nitrogen. Sequences of three genes omt, ord A, and afl R.3o A. O methyltransferase (Omt) gene from the published gene sequence with Accession no L25834 where the primers covers the region between 1811 to 2218 with the product size 407 by of SEQ ID NO. 7. L25834. Aspergillus pares... omt gene jgi:414297]1811 agcgtccgaatccctttaat ttgcttcgat ggctaattgt tccaacagtg 1861 catgcgtgga aatcctctcc aacatcgtca ccgccatgga cccaagcaag tcgcgcatcc 1921 ttctggacga aatgattatg cccgatcttt tggcgcagga ttcgcagcgc ttcatgaatc 1981 agatcgacat gactgttgtt ctgacattga acgggaagga gaggtctacc aaggagtgga 2041 attcgcttat tacgacggta gatggtagac tggagactga gaagatatgg tggcgcaaag . 2101 gcgaggaagg gtctcactgg ggcgttcaac aactgcgttt gcgcaagtag gggaatgcaa 2161 tggagatatc cttgggtctg tcagaagaac ggctgag ctatgattggcgaacaccct 2218 B. Oxidoreductase (ord) gene from the published gene sequence with Accession no AF169016 where the primer covers the region between 3142 to 3530 with product size 388 by of SEQ ID NO. 8. VERSION AF169016.1 GI:6715098 Aspergillus parasiticus oxidoreductase (ordA), versicolorin B synthase (vbs), cytochrome P450 monooxigenase (cyp~, and monooxigenase (moxl~ genes, complete cds 3142 actgcccct cagctaacct catactaatt aggacgttta 3181 cccatgatcc cagtgtctac cacgacccaa tggtgttcaa gccagagcga ttcctggagc 3241 gacaaagctc cccgccggaa acggatccca tgaaatttgt gttcggcttt gggcgtcgta 3301 tatgccccgg tcggtttgta acagacgaaa agctattttt gattgcgtgc cacgccatca 3361 gttgcttctt gatctcgccc aaggatccag gagctccgga acccgactgg ttgccgggcg 3421 tcatcagtca accgggcccc tttgacctca atgtggtgcc tcgcagccct gctcacgaag 3481 aattgattcg ttcaatcgag acggaccat ccttggaagaatgctgatgc 3530 C . Aflotoxin regulatory gene (aflR) from the published gene sequence with Accession no AF 264763 where the said primer covers the region between 540 to 1338 with the product size 798 by of SEQ ID NO. 9.Aspergillus sojae strain ATCC 42251 AFLR regulatory protein (aflR) gene, complete cds. ACCESSION AF264763 VERSION AF264763.1 GI:8572226 540 aaccgcatcca caatctcatc ctcaatcgaa tcaaccacca cacgctctgc ccacccccaa 601 tggtagcagt agcgtctccg ccatcttttc tcaccagagt cccccgccac tcgtggagac 661 ccagggcctt ggaggagatc tggctggtca ggcgcaaagc accctgtctt ccctaacagt 721 cgattcggaa ttcgggggct ctttgcagtc aatggaacac ggaaaccatg ccgatttctt 781 ggcggagtcg acggggagtc ttttcgacgc gtttttggaa gtggggaccc ccatgatcga 841 cccgttcctc gagtcggccc cactgccacc gtttcaggcg cgctattgct gcttttcgct 901 agcactacaa acactgacct gcctcttccc ccacgccccg ctgggctgtc agctgcggct 961 gacggacggt gaggacagtt cgtgcaacct gatgacgact gatatggtca tctcggggaa 1021 caagaaggct accgatgcgg tccggaagat cctcgggtgt tcgtgcgcgc aggatggcta 1081 cttgctgagc atggtcgtcc ttatcgttct caaggtgctg gggtggtatg ctgcggcagc 1141 aggcacccag tgtacctcaa cggcggcggg tggagaaacc aacagtggca gctgtagcaa 1201 cagtcccgcc accgtgtcca gtggctgtct gacggaagag cgcgtgctgc accaccctag 1261 tatggtgggc gaggattgtg tggatgagga agaccagccg cgagtggcgg cacagcttgt 1321 tctgagcgaactgcact 1338
    权利要求:
    Claims (27)
    [1] 1. Three sets of oligonucleotide primers of SEQ ID Nos. 1 through 6.
    [2] 2. Primers as claimed in claim 1, wherein said primers are designed from genes of aflatoxin biosynthesis pathway of fungi Aspergillus flavus.
    [3] 3. Primers as claimed in claim 2, wherein said primers are designed for three specific genes omt, ord, and afl R.
    [4] 4. Primers as claimed in claim 1, wherein primers 1 and 2 correspond to gene omt encoding o-methyl transferase.
    [5] 5. Primers as claimed in claim 4, wherein said primers cover the region between 1811 to 2218 in gene omt with the product size of 407 bp.
    [6] 6. Primers as claimed in claim 1, wherein primers 3 and 4 correspond to gene ord encoding oxidoreductase.
    [7] 7. Primers as claimed in claim 6, wherein said primers cover the region between 3142 to 3530 in gene ord with the product size of 388 bp.
    [8] 8. Primers as claimed in claim 1, wherein primers 5 and 6 correspond to gene afl Rencoding aflatoxin regulatory protein.
    [9] 9. Primers as claimed in claim 8, wherein said primers cover the region between 540 to 1338 in gene aflR with the product size of 798 bp.
    [10] 10. Primers as claimed in claim 1, wherein primers 1, 3, and 5 are forward primers.
    [11] 11. Primers as claimed in claim 1, wherein primers 2, 4, and 6 are reverse primers.
    [12] 12. Primers as claimed in claim 1, wherein length of primers is 20 base pairs (bp).
    [13] 13. An improved use of identifying aflatoxigenic aspergilli using primers of claim 1 independently or in combination, said use comprising steps of:(a) harvesting mixed microflora from food system, (b) extracting DNA from said harvested flora, (c) amplifying DNA by PCR using said primers, (d) analyzing amplified DNA by electrophoresis, and (e) identifying aflatoxigenic fungi.
    [14] 14. A use as claimed in claim 13, wherein fungi are harvested by centrifugation.
    [15] 15. A use as claimed in claim 13, wherein DNA is extracted using mixture of phenol, chloroform, and amyl alcohol in ratio of about 25:24:1.
    [16] 16. A use as claimed in claim 13, wherein primers are designed using software programme Primer 3Ø
    [17] 17. A use as claimed in claim 13, wherein primers 1 and 2 amplify 406 base pairs (bp) fragment of gene omt.
    [18] 18. A use as claimed in claim 13, wherein primers 3 and 4 amplify 387 base pairs (bp) fragment of gene ord.
    [19] 19. A use as claimed in claim 13, wherein primers 5 and 6 amplify 1299 base pairs (bp) fragment of gene afl R.
    [20] 20. A use as claimed in claim 13, wherein amplification mixture for amplifying DNAcomprises Tris-HCl, Potassium Chloride (KCl), Magnesium Chloride (MgCl2), gelatin, deoxyribonucleoside triphosphates, primers, Taq DNA polymerase, and sterile ultra filtered water.
    [21] 21. A use as claimed in claim 13, wherein electrophorizing amplified DNA using agarose gel.
    [22] 22. A use as claimed in claim 13, wherein said use identifies aflatoxigenic fungi as young as 12 hrs old.
    [23] 23. A use as claimed in claim 13, wherein said use is particularly useful in detecting aflatoxigenic Aspergillus flavus, and Aspergillus parasiticus.
    [24] 24. A use as claimed in claim 13, wherein said use detects aflatoxigenic fungi directly in food grains.
    [25] 25. A use as claimed in claim 13, wherein said use detects aflatoxigenic fungi from 10 -2 to -6 cell numbers in grains.
    [26] 26. A use as claimed in claim 13, wherein said use extracts DNA without using liquid nitrogen.
    [27] 27. A use as claimed in claim 13, wherein said use with three sets of primer used together shows more accurate identification as compared to any one set of primer alone.
    类似技术:
    公开号 | 公开日 | 专利标题
    Rodríguez et al.2012|Real-time PCR assays for detection and quantification of aflatoxin-producing molds in foods
    Silva et al.2011|Identification of fungi of the genus Aspergillus section nigri using polyphasic taxonomy
    Rodríguez et al.2011|Quantification of ochratoxin A-producing molds in food products by SYBR Green and TaqMan real-time PCR methods
    González-Salgado et al.2008|Highly sensitive PCR-based detection method specific for Aspergillus flavus in wheat flour
    Gil-Serna et al.2009|Discrimination of the main Ochratoxin A-producing species in Aspergillus section Circumdati by specific PCR assays
    Schmidt et al.2004|Utilization of AFLP markers for PCR‐based identification of Aspergillus carbonarius and indication of its presence in green coffee samples
    Luque et al.2013|Development of a PCR protocol to detect ochratoxin A producing moulds in food products
    Rodríguez et al.2012|Development of a multiplex real-time PCR to quantify aflatoxin, ochratoxin A and patulin producing molds in foods
    Jedidi et al.2018|Mycoflora isolation and molecular characterization of Aspergillus and Fusarium species in Tunisian cereals
    Flórez et al.2007|Morphotypic and molecular identification of filamentous fungi from Spanish blue-veined Cabrales cheese, and typing of Penicillium roqueforti and Geotrichum candidum isolates
    Chiotta et al.2011|Phylogenetic characterization and ochratoxin A–Fumonisin profile of black Aspergillus isolated from grapes in Argentina
    Yaguchi et al.2012|Method for identifying heat-resistant fungi of the genus Neosartorya
    Luque et al.2011|Development of a PCR protocol to detect patulin producing moulds in food products
    Mahmoud2015|Detection of Aspergillus flavus in stored peanuts using real-time PCR and the expression of aflatoxin genes in toxigenic and atoxigenic A. flavus isolates
    Mahmoud et al.2014|Molecular characterization of aflatoxigenic and non-aflatoxigenic Aspergillus flavus isolates collected from corn grains
    Vegi et al.2013|Multiplex real‐time PCR method for detection and quantification of mycotoxigenic fungi belonging to three different genera
    Cornea et al.2011|Incidence of fungal contamination in a Romanian bakery: a molecular approach
    Gimeno et al.2019|TaqMan qPCR for quantification of Clonostachys rosea used as a biological control agent against Fusarium graminearum
    Nakayama et al.2010|A rapid method for identifying Byssochlamys and Hamigera
    Ramírez et al.2001|Use of molecular markers to differentiate between commercial strains of the button mushroom Agaricus bisporus
    Frisch et al.2021|Development and optimization of a loop-mediated isothermal amplification | assay for the species-specific detection of Penicillium expansum
    Zachová et al.2003|Detection of aflatoxigenic fungi in feeds using the PCR method
    US6623932B1|2003-09-23|Primers for identifying aflatoxinogenic aspergilli and an improved method thereof
    Bezuidenhout et al.2006|Multiplex PCR‐based detection of potential fumonisin‐producing Fusarium in traditional African vegetables
    Patiño et al.2006|Characterization of Fusarium verticillioides strains by PCR‐RFLP analysis of the intergenic spacer region of the rDNA
    同族专利:
    公开号 | 公开日
    BR0215666A|2005-02-22|
    AU2002247930A1|2003-10-08|
    DK1490510T3|2008-09-15|
    EP1490510B1|2008-05-14|
    EP1490510A1|2004-12-29|
    引用文献:
    公开号 | 申请日 | 公开日 | 申请人 | 专利标题
    法律状态:
    2007-02-20| EEER| Examination request|
    2010-12-13| FZDE| Dead|
    优先权:
    申请号 | 申请日 | 专利标题
    PCT/IB2002/001162|WO2003080866A1|2002-03-26|2002-03-26|Novel primers for identifying aflatoxinogenic aspergilli and an improved use thereof|
    [返回顶部]